Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: SEMA4C is associated with decreased survival in colon cancer patients and is linked with increased invasiveness in colon cancer cells. Prognostic power of SEMA4C in colon cancer was analyzed with cancer multiomics database DriverDBv3 in terms of overall (A) and disease-free (B) survival. Peptide expression of SEMA4C in colon cancer and normal tissue (C) was analyzed with the mass spectrometry result from reference 36. Human colon cancer cell line HCT116 (D-H) and mouse colon cancer cell line CT26 (I-M) were treated with control IgG or SEMA4C antibody and analyzed with flow cytometry (D, I), antibody internalization assay (E, J), assays of proliferation (F, K), migration (G, L), and invasion (H, M).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Expressing, Mass Spectrometry, Flow Cytometry, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Ectopically expressed SEMA4C increases colon cancer motility. HCT116 (A, C, E, G) and SW480 (B, D, F, H) were transfected with control vector or SEMA4C-overexpressing plasmid, and analyzed for expression (A, B), proliferation (C, D), migration (E, F), and invasion (G, H).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Transfection, Plasmid Preparation, Expressing, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: RNA sequencing reveals the alteration of cell adhesion pathway in SEMA4C-overexpressing colon cancer cells. RNA sequencing results from TCGA colon cancer dataset (A, C) or the present study (B, D) were analyzed for SEMA4C-associated biological pathways (A, B) and gene sets (C, D). For validation, HCT116 (E, G) and CT26 (F) cells were subjected to SEMA4C blockage (E, F) or SEMA4C overexpression (G) and the results were analyzed for cell adhesion (E-G).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: RNA Sequencing Assay, Over Expression

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: SEMA4C affects tubulin acetylation via CRMP3. HCT116 (A, B, D, F-I) and CT26 (C, E) under the condition of SEMA4C blockage (A, B) or SEMA4C overexpression (C) were analyzed for alterations in total protein acetylation on lysine and tubulin acetylation. In addition, expressions of total tubulin and CRMP3 were also investigated. GAPDH served as internal control. Protein-protein interactions between SEMA4C and CRMP3 in HCT116 (D) and CT26 (E) were determined by immunoprecipitation of CRMP3 and subsequent Western blotting with human- or mouse-specific SEMA4C antibody as described. In functional validation, HCT116 cells were transfected with control vector or CRMP3-overexpressing plasmid and treated with control IgG or SEMA4C antibody (F, G) for cell migration (F) and invasion assays (G). On the other hand, HCT116 cells were transfected with control vector or SEMA4C-overexpressing plasmid, followed by transfection of shRNA against luciferase or against CRMP3 (H, I), with their effects on migration (H) and invasion (I) being analyzed as well.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Over Expression, Immunoprecipitation, Western Blot, Functional Assay, Transfection, Plasmid Preparation, Migration, shRNA, Luciferase

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: HDAC inhibitor Vorinostat inhibits SEMA4C-increased cell motility. TCGA colon cancer based- and L1000CDS2-predicted SEMA4C-counteracting therapeutics were shown (A) and HDAC inhibitor was selected for in vitro validation on proliferation (B), migration (C), and invasion (D) in HCT116.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: In Vitro, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Dual targeting of SEMA4C by neutralizing antibody and miRNA synergistically suppresses cell invasiveness. miRNAs targeting SEMA4C were identified by overlapping predicted miRNA from databases miRDB, TargetScan, and miRWalk, and the prognostic power of predictive miRNA let-7b (A) and its targeting onto SEMA4C 3’-UTR (B) were shown. Effect of let-7b mimic on proliferation in HCT116 was checked (C). Effects of dual targeting by neutralizing antibody and let-7b mimic on SEMA4C expression (D), migration (E), and invasion (F) in HCT116 were analyzed.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Expressing, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Inhibition of SEMA4C reduces PD-L1 level in colon cancer cells. Correlation of PD-L1 (CD274) and SEMA4C in TCGA COAD dataset was shown (A). Effect of SEMA4C antibody blockage (B) or SEMA4C overexpression (C) on PD-L1 expression in HCT116 was analyzed by Western blotting.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Inhibition, Over Expression, Expressing, Western Blot

Journal: JCI Insight

Article Title: Caspase-8 loss radiosensitizes head and neck squamous cell carcinoma to SMAC mimetic–induced necroptosis

doi: 10.1172/jci.insight.139837

Figure Lengend Snippet: ( A ) CRISPR/Cas9 was used to knock out CASP8 in the mouse-derived MOC1 cell line. MOC1 parental cells were transiently transfected with 2 sgRNAs designed against mouse Casp8 (sgRNA-mCASP8 #1 and sgRNA-mCASP8 #2) or a nontargeting sgRNA, after which clonal selection/expansion was performed. Engineered clones were subjected to a Western blot screen to identify Casp8WT and Casp8KO MOC1 clones. ( B ) Indicated Casp8WT and Casp8KO MOC1 clones were treated with birinapant (B [1 μmol/L]), Z-VAD-FMK (Z [5 μmol/L]), necrostatin-1s (N [10 μmol/L]), or the combinations for 24 hours. Cell viability was assessed using CellTiter-Glo. Values normalized to nontreated cells from the same experiment to calculate percentage of cell density. All treatments were carried out in replicates of 4. ( C ) Indicated Casp8WT and Casp8KO MOC1 clones were subjected to Western blot analysis for necroptosis markers RIP1, RIP3, and MLKL. ( D ) RIP3 was knocked down using shRNA in 2 necroptosis-sensitive MOC1 clones: the Casp8WT C2 and Casp8KO g2-1 clones. Scrambled shRNA control and shRip3 cells were subjected to Western blot to validate knockdown of RIP3. ( E ) Control and shRip3 C2 (Casp8WT) and g2-1 (Casp8KO) MOC1 clones were treated with birinapant (B [1 μmol/L]), Z-VAD-FMK (Z [5 μmol/L]), necrostatin-1s (N [10 μmol/L]), or the combinations for 24 hours. Cell viability was assessed by CellTiter-Glo. All treatments were carried out in replicates of 4. ( F ) Necroptosis-resistant C4 (Casp8WT) and g2-2 (Casp8KO) MOC1 clones were transduced with control, HA-tagged WT Rip3, or HA-tagged D143N Rip3 (a kinase domain dead RIP3) inducible expression constructs. RIP3 expression was induced with doxycycline (50 ng/mL). Western blot analysis was performed to validate expression of WT or D143N Rip3 in the indicated MOC1 clones. Relative RIP3 expression was quantified using parental cells in C and F and C2 control cells in D as reference control, and β-actin was used as loading control. ( G ) Cells engineered in F were treated with birinapant (B [1 μmol/L]), Z-VAD-FMK (Z [5 μmol/L]), necrostatin-1s (N [10 μmol/L]), or the combinations for 24 hours. Cell viability was assessed by CellTiter-Glo. One-way ANOVA with post hoc Bonferroni-corrected t test was used for statistics. * P < 0.05; ** P < 0.001 for the indicated pairwise comparisons. All experiments detailed above were repeated 3 times with similar results.

Article Snippet: Select MOC1 clones that showed lack of protein expression of Rip3 were transduced with inducible lentiviral vectors encoding WT (plasmid 73701) or kinase-dead mutant (D143N) Rip3 (plasmid 73703) purchased from Addgene (these plasmids were gifted by F. Chen, University of Massachusetts Medical School, Worcester, Massachusetts, USA).

Techniques: CRISPR, Knock-Out, Derivative Assay, Transfection, Selection, Clone Assay, Western Blot, shRNA, Control, Knockdown, Transduction, Expressing, Construct

Journal: JCI Insight

Article Title: Caspase-8 loss radiosensitizes head and neck squamous cell carcinoma to SMAC mimetic–induced necroptosis

doi: 10.1172/jci.insight.139837

Figure Lengend Snippet: ( A ) Cell lysates obtained from a panel of 5 CASP8 WT and 4 CASP8 mutant human-derived HNSCC cell lines were subjected to Western blot analysis for caspase-8 and key necroptosis markers; β-actin was used as loading control. Cell lines were treated with birinapant (B [1 μmol/L]), Z-VAD-FMK (Z [5 μmol/L]), necrostatin-1s (N [10 μmol/L]), or the combinations for 24 hours. Cell viability was assessed using CellTiter-Glo. Then, “% necroptosis” was used to assess necroptosis sensitivity for each cell line and calculated based on percentage reduction in cell density with birinapant plus Z-VAD-FMK treatment that was reversible by necrostatin-1s. This is a measure of necroptotic death. Please refer to for detailed analysis. ( B ) Scatter plot shows gene expression for RIP3 in a panel of 80 human-derived HNSCC cell lines. Median with 95% CI values are shown by the bar. Cell lines used for the Western blot analysis were highlighted. ( C ) RIP3 gene expression in TCGA HPV-negative oral cancer samples. Median with 95% CI values are shown by the bar.

Article Snippet: Select MOC1 clones that showed lack of protein expression of Rip3 were transduced with inducible lentiviral vectors encoding WT (plasmid 73701) or kinase-dead mutant (D143N) Rip3 (plasmid 73703) purchased from Addgene (these plasmids were gifted by F. Chen, University of Massachusetts Medical School, Worcester, Massachusetts, USA).

Techniques: Mutagenesis, Derivative Assay, Western Blot, Control, Gene Expression